oligonucleotide array surfaces (Spatial Transcriptomics Inc)
86
Structured Review
Spatial Transcriptomics Inc
oligonucleotide array surfaces
Oligonucleotide Array Surfaces, supplied by Spatial Transcriptomics Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oligonucleotide+array/array+oligonucleotide+surfaces/pmc12579210-0-14-0
Average 86 stars, based on 1 article reviews
Oligonucleotide Array Surfaces, supplied by Spatial Transcriptomics Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oligonucleotide+array/array+oligonucleotide+surfaces/pmc12579210-0-14-0
Average 86 stars, based on 1 article reviews
oligonucleotide array surfaces - by Bioz Stars,
2026-10
86/100 stars
Images
Related Articles
other:Article Title: Spatially resolved transcriptomics reveals plant host responses to pathogens. Article Snippet: However, all three methods need specific tissue preparations (e.g. cryo-sectioning, permeabilization or fixation) and specialised protocols to assess transcriptome levels: FISH methods require imaging of transcripts and are restricted to multiplexing a few fluorescent anti-sense probes at a time [3], LCM requires specialised equipment and training for precise, laborious excision of specific tissue elements [6] and the SPATiAL TRANSCRIPTOMICS protocol requires preparation of thinly sectioned, permeabilised samples and custom made DNA arrays [4, 6]. Article Title: Tissular chromatin-state cartography based on double-barcoded DNA arrays that capture unloaded PA-Tn5 transposase Article Snippet: Like in our previous study describing the use of double-barcoded DNA arrays for spatial transcriptomics , we have used BCr oligonucleotides presenting an amino C6 linker at the 5′ extremity, followed by four G or C nucleotides (S), a T7 promoter sequence (GACTCGTAATACGACTCACTATAGGG), a unique molecular identifier (UMI; WSNNWSNNV), a molecular barcode (8 nt) associated to the printed row in the DNA array, and a 30 nt adapter sequence with a GC-content of 40% (here named as Gibson sequence “ACATTGAAGAACCTG-TAGATAACTCGCTGT”). Spatial Transcriptomics:Article Title: DNA microarray chips: Fabrication and cutting-edge applications Article Snippet: For decades, DNA chips, also known as DNA microarrays, have been extensively utilized for high-throughput gene expression analysis and single nucleotide polymorphism (SNP) genotyping.. However, its utility extends far beyond these applications.. Its use as a chip for Next Generation Sequencing (NGS) has brought about a revolutionary impact on many aspects of life science research. Article Title: Spatially resolved transcriptomics reveals plant host responses to pathogens Article Snippet: Thus methods such as fluorescent in-situ hybridisation (FISH) [ ], laser-capture microdissection (LCM) [ – ] or the SPATiAL TRANSCRIPTOMICS [ , ] workflow are better suited to understand spatial transcription changes. .. However, all three methods need specific tissue preparations (e.g. cryo-sectioning, permeabilization or fixation) and specialised protocols to assess transcriptome levels: FISH methods require imaging of transcripts and are restricted to multiplexing a few fluorescent anti-sense probes at a time [ ], LCM requires specialised equipment and training for precise, laborious excision of specific tissue elements [ ] and the SPATiAL TRANSCRIPTOMICS protocol requires preparation of thinly sectioned, permeabilised samples and custom made Article Title: Multimodal Mass Spectrometry Imaging in Atlas Building: A Review. Article Snippet: .. Spatial transcriptomics is a rapidly evolving field involving the measurement and localization of gene expression that can be used to understand the mechanisms behind disease and disorder.106 Current commercial Article Title: Hidden network preserved in Slide-tags data allows reference-free spatial reconstruction Article Snippet: .. Spatial transcriptomics technologies aim to spatially map gene expression in tissues and typically use Fluorescence In Situ Hybridization:Article Title: Spatially resolved transcriptomics reveals plant host responses to pathogens Article Snippet: Thus methods such as fluorescent in-situ hybridisation (FISH) [ ], laser-capture microdissection (LCM) [ – ] or the SPATiAL TRANSCRIPTOMICS [ , ] workflow are better suited to understand spatial transcription changes. .. However, all three methods need specific tissue preparations (e.g. cryo-sectioning, permeabilization or fixation) and specialised protocols to assess transcriptome levels: FISH methods require imaging of transcripts and are restricted to multiplexing a few fluorescent anti-sense probes at a time [ ], LCM requires specialised equipment and training for precise, laborious excision of specific tissue elements [ ] and the SPATiAL TRANSCRIPTOMICS protocol requires preparation of thinly sectioned, permeabilised samples and custom made Imaging:Article Title: Spatially resolved transcriptomics reveals plant host responses to pathogens Article Snippet: Thus methods such as fluorescent in-situ hybridisation (FISH) [ ], laser-capture microdissection (LCM) [ – ] or the SPATiAL TRANSCRIPTOMICS [ , ] workflow are better suited to understand spatial transcription changes. .. However, all three methods need specific tissue preparations (e.g. cryo-sectioning, permeabilization or fixation) and specialised protocols to assess transcriptome levels: FISH methods require imaging of transcripts and are restricted to multiplexing a few fluorescent anti-sense probes at a time [ ], LCM requires specialised equipment and training for precise, laborious excision of specific tissue elements [ ] and the SPATiAL TRANSCRIPTOMICS protocol requires preparation of thinly sectioned, permeabilised samples and custom made Multiplexing:Article Title: Spatially resolved transcriptomics reveals plant host responses to pathogens Article Snippet: Thus methods such as fluorescent in-situ hybridisation (FISH) [ ], laser-capture microdissection (LCM) [ – ] or the SPATiAL TRANSCRIPTOMICS [ , ] workflow are better suited to understand spatial transcription changes. .. However, all three methods need specific tissue preparations (e.g. cryo-sectioning, permeabilization or fixation) and specialised protocols to assess transcriptome levels: FISH methods require imaging of transcripts and are restricted to multiplexing a few fluorescent anti-sense probes at a time [ ], LCM requires specialised equipment and training for precise, laborious excision of specific tissue elements [ ] and the SPATiAL TRANSCRIPTOMICS protocol requires preparation of thinly sectioned, permeabilised samples and custom made Laser Capture Microdissection:Article Title: Spatially resolved transcriptomics reveals plant host responses to pathogens Article Snippet: Thus methods such as fluorescent in-situ hybridisation (FISH) [ ], laser-capture microdissection (LCM) [ – ] or the SPATiAL TRANSCRIPTOMICS [ , ] workflow are better suited to understand spatial transcription changes. .. However, all three methods need specific tissue preparations (e.g. cryo-sectioning, permeabilization or fixation) and specialised protocols to assess transcriptome levels: FISH methods require imaging of transcripts and are restricted to multiplexing a few fluorescent anti-sense probes at a time [ ], LCM requires specialised equipment and training for precise, laborious excision of specific tissue elements [ ] and the SPATiAL TRANSCRIPTOMICS protocol requires preparation of thinly sectioned, permeabilised samples and custom made RNA Sequencing:Article Title: Old school, new rules: floral meristem development revealed by 3D gene expression atlases and high-resolution transcription factor–chromatin dynamics Article Snippet: Spatial transcriptomics methods detect the positional context of transcriptional activity in intact plants at a higher resolution than previously available approaches, either for regions or single cells. .. Spatial transcriptomics was initially developed for mammalian systems, using Gene Expression:Article Title: Multimodal Mass Spectrometry Imaging in Atlas Building: A Review. Article Snippet: .. Spatial transcriptomics is a rapidly evolving field involving the measurement and localization of gene expression that can be used to understand the mechanisms behind disease and disorder.106 Current commercial Article Title: Hidden network preserved in Slide-tags data allows reference-free spatial reconstruction Article Snippet: .. Spatial transcriptomics technologies aim to spatially map gene expression in tissues and typically use Sequencing:Article Title: Multimodal Mass Spectrometry Imaging in Atlas Building: A Review. Article Snippet: .. Spatial transcriptomics is a rapidly evolving field involving the measurement and localization of gene expression that can be used to understand the mechanisms behind disease and disorder.106 Current commercial In Situ:Article Title: Multimodal Mass Spectrometry Imaging in Atlas Building: A Review. Article Snippet: .. Spatial transcriptomics is a rapidly evolving field involving the measurement and localization of gene expression that can be used to understand the mechanisms behind disease and disorder.106 Current commercial |